Skip to main content

Table 1 Primers amplification of the entire CDS of gC, gD, gH, gE, and TK genes of PRV

From: Vaccine resistant pseudorabies virus causes mink infection in China

Primers Sequence Position (bp) Length (bp) Annealing temperature GenBank accession
gB-F CTGGTGGCGGTCTTAGGCG 8–27 2738 60 KJ526439
gB-R CTACAGGGCGTCGGGGTCC 2726–2744
gC-F GCTCGTGCAGGCGTACGT 53,326–53,343 1625 55 AF158090
gC-R GCGGTCGTTTATTGATTCGG 54,950–54,931
gD-F CCCAGGTTCCCATACACTCAC 121,236–121,256 1258 55 AF086702
gD-R TACTGCGGAGGCTACGGAC 122,487–126,469
gE-F AGACCATGCGGCCCTTTC 122,353–122,370 2710 58 AY249861
gE-R ACGACCACTCCGTGTCCAGC 125,090–125,071
gH-F GGAGATGGGGGTGTGACC 59,631–59,648 3108 53 M61196
gH-R GCGGCAGACACTTTAACTCTTG 62,701–62,680
TK-F AGGCGTTCGTAGAAGCGGT 59,195–59,213 1147 56 AY217095
TK-R GGGCACGGCAAACTTTATTG 60,340–60,321