Skip to main content

Table 1 Primer sequences, amplicon length (AE), annealing temperature (T), efficiency (E) and gene reference

From: Effects of the isoflavone genistein in early life stages of the Senegalese sole, Solea senegalensis: role of the Survivin and proliferation versus apoptosis pathways

Target Sequence (5’→3′) AE (bp) T (°C) Ea Gene reference
BIRC-5 TGATCCAGAAAAGGAGCACA (F);
TGGTGTCGTTGCAGGATTTA (R)
149 56 2.0799 solea_v4.1_unigene59754*
Caspase-6 CAGGACATCACAGCCATGTT (F);
TCACTGTCCACAGCATCACA (R)
134 60 2.0205 solea_v4.1_unigene3643*
Fas AGCCACTGCTCTGTGAAACC (F);
CTAGGTTTGCGTTGGGATGT (R)
130 60 2.0403 solea_v4.1_unigene23355*
  1. a100% efficiency is E = 2 and corresponds to a slope of −3.32. to accept the standar curve the R2 value must be >0.99
  2. *Database Solea BD. http://www.juntadeandalucia.es/agriculturaypesca/ifapa/soleadb_ifapa/