Skip to main content

Table 2 Primer sets used for the detection of virulence genes in Streptococcus spp.

From: Biofilm production and other virulence factors in Streptococcus spp. isolated from clinical cases of bovine mastitis in Poland

Primer function Putative function Target gene Primer sequence (5′–3′) Amplicon size (bp) Annealing temperature (°C) Reference
Virulence genes
S.uberis
Adhesion molecue- Adherence and invasion of mammary epithelial cells sua TCAACTTGACGAATCGCTTG
TCAGCCATTGTTTCTGCTTG
480 47 [20]
Plasminogen activator colonization pauA/skc CGGGTTGAAGAACCTATCACTC
TGGAAGTTGACCAAGAGAATTG
255 50 [20]
Surfacedehydrogenase protein colonization gapC GCTCCTGGTGGAGATGATGT
GTCACCAGTGTAAGCGTGGA
200 51 [11]
CAMP factor Forms pores in host-cell membran cfu TATCCCGATTTGCAGCCTAC
CCTGGTCAACTTGTGCAACTG
205 50 [11]
Lactoferrin binding protein Binding Lactoferrin lbp CGACCCTTCAGATTGGATTC
TAGCAGCATCACGTTCTTCG
698 50 [11]
Hyaluronic acid capsule Resistance to phagocytosis hasA GAAAGGTCTGATGCTGATG
TCATCCCCTATGCTTACAG
319 44 [33]
hasB TCTAGACGCCGATCAAGC
TGAATTCCTATGCGTCGATC
532 47 [33]
hasC TGCTTGGTGACGATTTGATG
GTCCAATGATAGCAAGGTCAC
225 47 [33]
S.agalactiae
Adherence and virulence protein A Binding to immobilized fibronectin pavA TTCCCATGATTTCAACAACAAG
AACCTTTTGACCATGAATTGGTA
495 47 [20]
Streptococcal C5a peptidase- adhesion Prevents neutropil, promotes adherence scpB AGTTGCTTCTTACAGCCCAGA
GGCGCAGACATACTAGTTCCA
567 51 [20]
Surface protein Rib- Resistance to proteases rib CAGGAAGTGCTGTTACGTTAAAC
CGTCCCATTTAGGGTCTTCC
369 51 [34]
C beta protein Binds to the immuno-globulin A bac CTATTTTTGATATTGACAATGCAA
GTCGTTACTTCCTTGAGATGTAAC
592 46 [35]
Β-haemolisin Promotes invasion of host cells cylE TGACATTTACAAGTGACGAAG
TTGCCAGGAGGAGAATAGGA
248 47 [36]
C alfa protein Adherence to epithelial cells bca TAACAGTTATGATACTTCACAGAC
ACGACTTTCTTCCGTCCACTTAGG
535 49 [37]
CAMP factor Forms pores in host-cell membran cfb ATGGGATTTGGGATAACTAAGCTAG
AGCGTGTATTCCAGATTTCCTTAT
193 50 [38]
Lamining-binding protein Promote adherence to host laminin lmb AGTCAGCAAACCCCAAACAG
GCTTCCTCACCAGCTAAAACG
397 50 [39]
S.dysgalactiae
α-enolase Plasminogen binding eno ATGTCAATTATTACTGATGT
CTATTTTTTTAAGTTATAGA
1308 36 [17]
Nephritis-associated plasminogen-binding receptor Plasminogen binding napr GTTAAAGTTGGTATTAACGGT
TTGAGCAGTGTAAGACATTTC
963 45 [17]