Skip to main content

Table 3 Sequencing results of positive phage colonies with specifically binding to BEFV G1 protein

From: Biopanning of polypeptides binding to bovine ephemeral fever virus G1 protein from phage display peptide library

Groups Phage clones Phage displayed peptide DNA sequence Phage displayed peptide amino acid sequence Poly-peptide names
1 4, 11, 12, 23, 25 TATTCTCTTCGTTCTGATTAT YSLRSDY T25
2 5, 6, 20 TATTCTCTTCGTCAGGATTGG YSLRQDW T20
3 1, 13, 19 TATAGTTTGCGTACTGATTGG YSLRTDW T19
4 16, 22, 26 TATTCTCTTCGTCAGGAGAGG YSLRQER T26
5 14, 24 TATAGTTTGCGTGCGGATCGT YSLRADR T24
6 10, 17 GCTCTGAGTAGTCTGCGTAAT ALSSLRN T17
7 3, 18 CATTCTATTCGGTATGATTTT HSIRYDF T18
8 2, 15 CATAGTATTCGTGTTGATTGG HSIRVDW T15
9 21 GATTGGATTTTTCCTGCGTTT DWIFPAF T21
10 9, 27 AAGGTTTGGATTGTTCCTTCT KVWIVPS T27
11 7, 8 AAGGTTTGGTTGCTTCATTCT KVWLLHS T8