Skip to main content

Table 1 The sequences of primers used in real-time RT-PCR

From: Biopanning of polypeptides binding to bovine ephemeral fever virus G1 protein from phage display peptide library

Gene   Sequences (5′-3′) Amplicon size(bp)
BEFV N N-F TCCTTCACCATGTACTGCAC 138
N-R ACCTTGTGGCACTCTCAAC
GAPDH GAPDH-F TCATGACCACAGTCCATGCC 144
GAPDH-R GGATGACCTTGCCCACAGCC