Skip to main content

Table 2 RPA primers and probe used for the rapid detection of IBRV

From: Rapid detection of infectious bovine Rhinotracheitis virus using recombinase polymerase amplification assays

Name Sequence (5’to 3′)
4F 5′-TTCCGACCAGCGCCGAATCTTGGATGCAGTACT-3’
4R 5′-【Biotin】GGCCAAAACCGCTTTCAGAAGCAGAGCAAGGTGA-3’
4LF 5′-【FAM】CCGCAAAGTGCCGAGGGATGTCCTTGTAGT【dSpacer】CAGGTCCACCTTCCGCT【C3-spacer】-3’
  1. Note: F Forward primer; R Reverse primer; LF probe; FAM Carboxyfluorescein; dSpacer A tetrahydrofuran residue; C3-spacer: 3′-block