Skip to main content

Table 1 The sequences of primers and probes designed in this study

From: Rapid detection of infectious bovine Rhinotracheitis virus using recombinase polymerase amplification assays

Primers Oligonucleotide sequences (5’to3’) Product sizes (bp) Location
1F: 5′-GGCAAGCGCCGCGAAGGAAACCAAGTCG-3′ 236 4013–7237
1R: 【Biotin】 5′-GGCTTTACTCCAACAGCGGTGCGACTCCCTTC-3’
1LF: 5′-【FAM】GCGAAGGAAACCAAGTCGGGGAAGGCGAGTC[dSpacer]CGAGGGGTTAGGCG【C3-spacer】-3’
2F 5′- GGGGACGGCCACGTACACTTGCTCGTCGTAGAGG −3′ 187 19,597–20,823
2R: 【Biotin】5′- TCTGTCCGACGGCGGCAACGGCAACCCAATC −3’
2-1LF1: AAAGGCGTTTCGCAGCGAGGCGCCAAAGGG[dSpacer]CTCAGCAGGGCGGAGAC-3′
2-2LF2: 5′-【FAM】AGGCGTTTCGCAGCGAGGCGCCAAAGGGG[dSpacer]TCAGCAGGGCGGAGACGT【C3-spacer】-3’
3F: 5′- ACACGAGGTCGCCGCCCGTGAAGACGCCGTTGTT −3′ 142 23,526–25,889
3R 【Biotin】5′- CCAATGGACGGAAAGGTGCCCGCCTCCCAGAT −3’
3LF: 5′-【FAM】CCGTTGTTGGTGGCCTTGCGGATCTTGCAG[dSpacer]AGTAGAGCCCCGTCTTA【C3-spacer】-3’
4-1F: 5′- TTGACAAAGACCGAGTCCGTGTCGCCGTAAACCA −3′ 274 45,238–48,978
4-1R: 【Biotin】5′- TCGATAAGCAGCAGGCCGCCATCAAGGTCGTGT −3′
4-1LF: 5′-【FAM】TGTGGCCCAGCGCTCGTGTATGTACCGCCG[dSpacer]GTCTCGAGCAGCATGTC【C3-spacer】-3’
4-2F 5′-GCTTTCCGACCAGCGCCGAATCTTGGATGCAGT −3′ 250 47,151–47,397
4-2R: 【Biotin】5′- GGCCAAAACCGCTTTCAGAAGCAGAGCAAGGTGA −3’
4-2LF: 5′-【FAM】CCGCAAAGTGCCGAGGGATGTCCTTGTAGT[dSpacer]CAGGTCCACCTTCCGCT【C3-spacer】-3’
4-3F: 5′- GCCACCGCCGACAGCTCCAGGTGGGGCAAGTAC −3′ 295 47,151–47,397
4-3R: 【Biotin】5′- CGGGCCAAAACCGCTTTCAGAAGCAGAGCAAGGT −3’
4-3LF: 5′-【FAM】CACCTTCCGCTCCCGCAGGGCCTCCTCGGC[dSpacer]ACGGCGTTGAGCTTGTA【C3-spacer】-3′
4-4F :5′- CTTTCCGACCAGCGCCGAATCTTGGATGCAGTA −3′ 154 47,151–47,397
4-4R: 【Biotin】5′- CAGCTACAAGCTCAACGCCGTGGCCGAGGAGGC −3’
4-4LF: 5′-【FAM】CCGCAAAGTGCCGAGGGATGTCCTTGTAGT[dSpacer]CAGGTCCACCTTCCGCTC【C3-spacer】-3′
gB-F: 5′- ACACGGACCGCGTGCCCGTGGGCATGGGCGAGATCA −3′ 257 55,015–58,579
gB-R: 【Biotin】5′- GCAGTTCACAGAGGTGCCCGTGCGGTAGAGCC −3’
gB-LF: 5′-【FAM】AGCGGGCGCAAGGTGGTGGCCTTTGACCGC[dSpacer]ACGACGACCCCTGGGAG【C3-spacer】-3′
  1. Note: F: Forward primer; R: Reverse primer; LF Probe; FAM Carboxyfluorescein; dSpacer A tetrahydrofuran residue; C3-spacer: 3′-block