Skip to main content

Table 3 Details of primers and qPCR conditions for the putative reference genes assessed in this study

From: Reference gene validation for gene expression normalization in canine osteosarcoma: a geNorm algorithm approach

Reference gene Accession number Forward primer 5′ to 3′ Reverse primer 5′ to 3′ Product length (bp) Ta (°C)
RPS5 XM_533568 TCACTGGTGAGAACCCCCT CCTGATTCACACGGCGTAG 141 62.5
RPS19 XM_533657 CCTTCCTCAAAAAGTCTGGG GTTCTCATCGTAGGGAGCAAG 95 61
HPRT AY_283372 AGCTTGCTGGTGAAAAGGAC TTATAGTCAAGGGCATATCC 114 56
HNRNPH XM_53857 CTCACTATGATCCACCACG TAGCCTCCATAACCTCCAC 151 61.2
RPL8 XM_532360 CCATGAATCCTGTGGAGC GTAGAGGGTTTGCCGATG 64 55
GAPDH NM_001003142 TGTCCCCACCCCCAATGTATC CTCCGATGCCTGCTTCACTACCTT 100 58
B2M XM_535458 TCCTCATCCTCCTCGCT TTCTCTGCTGGGTGTCG 85 61.2
SRPR XM_03184 GCTTCAGGATCTGGACTGC GTTCCCTTGGTAGCACTGG 81 61.2
GUSB NM_001003191 AGACGTTCCAAGTACCCC AGGTGTGGTGTAGAGGAGCAC 103 62
  1. T a annealing temperature, bp base pair