Skip to main content

Table 1 SiRNA for silencing as well as primers for plasmid construction and real-time PCR used in this study

From: Avian infectious bronchitis virus disrupts the melanoma differentiation associated gene 5 (MDA5) signaling pathway by cleavage of the adaptor protein MAVS

Purpose Name Sequence(5’ to3’) Accession no. References
Cloning of chMDA5 chMDA5-F1 AAAGATATCTATGTCGGAGGAGTGCCGA (EcoRV) GU570144.1  
chMDA5-R1 AATGGATCCCTTCTTTTGTCATC   
Cloning of chMDA5 chMDA5-F2 ACAAAAGAAGGGATCCATTTAGAG (overlap sequence)   
chMDA5-R2 CTAGTCTAGATTAATCTTCATCACTTGAAGGACAA (XbaI)   
Cloning of chTLR3 chTLR3-F ATAAGAATGCGGCCGCTAAACTAATGGGATGCTCTATTCCTTGCT (NotI) NM_001011691  
chTLR3-R AAAGATATCAATCAGCGCACTTTACTATTAGATTTAAG (EcoRV)   
Cloning of dgRIG- I dgRIG-I-F GGAATTCC ATGACGGCGGAGGAAAAG (EcoRI) JF804977.1  
dgRIG-I-R GAGGATCCTCAAATGGTGGGTACAAGTTGGAC (BamHI)   
Silencing SiMDA5 GAACGUGAAGAUGUAAAUATT   [22]
Silencing SiTLR3 GCAGAUUGUAGUCACCUAATT   [22]
Silencing SiMAVS UACAGGAGGCUUCAAGGAGGUGUCA   [22]
Silencing siRNA control AUUACGGGCCAGUAAUCUAT   
Real-time PCR chIFN-β F CAGCTCTCACCACCACCTTCTC   [24]
chIFN-β R GGAGGTGGAGCCGTATTCTG   
Real-time PCR chβ-actin F CAACACAGTGCTGTCTGGTGGTA   [27]
chβ-actin R ATCGTACTCCTGCTTGCTGATCC   
Real-time PCR chIFN-λ F TGAGCTGGACCTCACCATCA NM_001128496.1  
Real-time PCR chIFN-λ R GGGCTGTTGGCACGTCTCT   
Real-time PCR chMda5 F TGGAGCTGGGCATCTTTCAG   [23]
chMda5 R GTTCCCACGACTCTCAATAACAGT   
Real-time PCR chMx F TTGTCTGGTGTTGCTCTTCCT   [25]
chMx R GCTGTATTTCTGTGTTGCGGTA   
Real-time PCR IBV-GL533 GCCATGTTGTCACTGTCTATTG   [26]
IBV-GU391 GCTTTTGAGCCTAGCGTT   
IBV-Probe FAM-CACCACCAGAACCTGTCACCTC-BHQ   
  1. The underlined nucleotides are restriction enzyme sequences. Restriction enzymes are indicated in parentheses