Skip to main content

Table 2 Primer sequences of the reference gene (GAPDH) and pro-inflammatory cytokines IL1β, IL6 and TNFα used in the study

From: Local anaesthetics or their combination with morphine and/or magnesium sulphate are toxic for equine chondrocytes and synoviocytes in vitro

Gene GeneBank Accession Direction Primer Sequence (5′-3′)
GAPDH NM_001163856 Forward GCATCGTGGAGGGACTCA
Reverse GCCACATCTTCCCAGAGG
IL-1β NM_001317261 Forward GCCTAAGAATACTACATCCAGAGA
Reverse GGCATTGATTAGACAACAGTGAA
IL-6 NM_001082496 Forward CTGCTCCTCGTGATGGCTAC
Reverse CCGAGGATGTACTTAATGTGCTG
TNF-α NM_001081819 Forward CCTTCCACTCAATCAACCCTCT
Reverse CACGCCCACTCAGCCACT
  1. Primer sequences of the reference gene (GAPDH) and proinflammatory cytokines IL1β, IL6 and TNFα used in the study