Skip to main content

Table 2 Sequences of primers and probes for CPV-2 PCR, real-time PCR and real-time RPA assay

From: Development of real-time recombinase polymerase amplification assay for rapid and sensitive detection of canine parvovirus 2

Name Sequence 5′-3’Amplication size (bp)  
VP2-FP ATGAGTGATGGAGCAGTTCAACCAGAC 1775
VP2-RP TTAATATAATTTTCTAGGTGCTAGTTGA  
CPV-FP AAACAGGAATTAACTATACTAATATATTTA 93
CPV-RP AAATTTGACCATTTGGATAAACT  
CPV-P FAM-TGGTCCTTTAACTGCATTAAATAATG TACC-BHQ1  
CPV-RPA-FP CACTTACTAAGAACAGGTGATGAATTTGCT ACAG 214
CPV-RPA-RP AGTTTGTATTTCCCATTTGAGTTACACCACGTCT  
CPV-RPA-P CCTCAAGCTGAAGGAGGTACTAACTTTGGT/
BHQ1-dT//THF //FAM-dT/ATAGGAGTTCAAC
AAG-C3 spacer