Skip to main content

Advertisement

Table 3 Microorganisms, sequences and references for the primers used

From: Effects of dietary supplementation of leaves and whole plant of Andrographis paniculata on rumen fermentation, fatty acid composition and microbiota in goats

Microorganism Sequence 5′ – 3′ Product size (bp) Annealing temperature (°C) Reference
Total bacteria F CGGCAACGAGCGCAACCC 145 55 [18]
Total bacteria R CCATTGTAGCACGTGTGTAGCC
Total protozoa F CTTGCCCTCYAATCGTWCT 223 55 [19]
Total protozoa R GCTTTCGWTGGTAGTGTATT
Methanogens (mcrA)-F TTCGGTGGATCDCARAGRGC 140 55 [20]
Methanogens (mcrA)-R GBARGTCGWAWCCGTAGAATCC
Fibrobacter succinogenes GTTCGGAATTACTGGGCGTAAA 122 55 [21]
Fibrobacter succinogenes CGCCTGCCCCTGAACTATC
Ruminococcus albus CCCTAA AAGCAGTCTTAGTTCG 170 55 [18]
Ruminococcus albus CCTCCTTGCGGTTAGAACA
Ruminococcus flavefaciens F (Rf154f) TCTGGAAACGGATGGTA 259 55 [18]
Ruminococcus flavefaciens (Rf425r) CCTTTAAGACAGGAGTTTACAA
  1. F Forward, R Reverse