Skip to main content

Table 2 List of oligonucleotide primers used in this study

From: Quadruplex PCR assay for identification of Corynebacterium pseudotuberculosis differentiating biovar Ovis and Equi

Target gene Primers Sequence (5′ → 3′) Amplicom size (bp) Multiplex PCR assay Reference
16S rRNA a Forward ACCGCACTTTAGTGTGTGTG 816 Yes (25)
rpoB a Forward CGTATGAACATCGGCCAGGT 446 Yes (26)
pld a Forward ATAAGCGTAAGCAGGGAGCA 203 Yes (14)
narG a Forward ACCCGTACTTGCACTCTTTC 612 Yes Present Study
narT Forward GCTGAAGCAAGTTCGTGTCT 202 No Present Study
narK Forward GCTGAAGCAAGTTCGTGTCT 202 No Present Study
narG2 Forward CAACGTGGTACCTGGTATCTG 200 No Present Study
narH Forward GATTCTACTGACCGCCATCTC 196 No Present Study
narJ Forward CGTGATGGTATAGAGGTGCTG 198 No Present Study
narI Forward CTGTATCCACACAGGTGTTCG 215 No Present Study
  1. aPrimers used to quadriplex PCR assay