Skip to main content

Table 2 List of oligonucleotide primers used in this study

From: Quadruplex PCR assay for identification of Corynebacterium pseudotuberculosis differentiating biovar Ovis and Equi

Target gene Primers Sequence (5′ → 3′) Amplicom size (bp) Multiplex PCR assay Reference
16S rRNA a Forward ACCGCACTTTAGTGTGTGTG 816 Yes (25)
  Reverse TCTCTACGCCGATCTTGTAT    
rpoB a Forward CGTATGAACATCGGCCAGGT 446 Yes (26)
  Reverse TCCATTTCGCCGAAGCGCTG    
pld a Forward ATAAGCGTAAGCAGGGAGCA 203 Yes (14)
  Reverse ATCAGCGGTGATTGTCTTCCAGG    
narG a Forward ACCCGTACTTGCACTCTTTC 612 Yes Present Study
  Reverse AGTCAGTACTTCCGCAGGTC    
narT Forward GCTGAAGCAAGTTCGTGTCT 202 No Present Study
  Reverse GTAACGGTCAGAGAACCATCC    
narK Forward GCTGAAGCAAGTTCGTGTCT 202 No Present Study
  Reverse GTAACGGTCAGAGAACCATCC    
narG2 Forward CAACGTGGTACCTGGTATCTG 200 No Present Study
  Reverse CATAGGGAGAGCGAGAACAA    
narH Forward GATTCTACTGACCGCCATCTC 196 No Present Study
  Reverse ATCAGTACCTGTCATGCCTACC    
narJ Forward CGTGATGGTATAGAGGTGCTG 198 No Present Study
  Reverse GTTGGAAGCAGTAGGGAAGGGAG    
narI Forward CTGTATCCACACAGGTGTTCG 215 No Present Study
  Reverse GTATCCTACAGGCGCTGAGA    
  1. aPrimers used to quadriplex PCR assay
\