Skip to main content

Table 1 Sequence of primers and probes for CDV RT-PCR, real-time RT-PCR and RT-RPA assays

From: Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification

Name Sequence 5′-3′ Amplicon size (bp)
N-Forward ATGGCCAGCCTTCTTAAG 1572
N-Reverse TTAATTGAGTAGCTCTCTATCA
CDV-F AGCTAGTTTCATCTTAACTATCAAATT 87
CDV-R TTAACTCTCCAGAAAACTCATGC
CDV-P FAM-ACCCAAGAGCCGGATACATAGTTTCAATGC-BHQ1
CDV-RPA-F GCTTACTTCAGACTCGGGCAAGAAATGGTTA 154
CDV-RPA-R CAGTAGCTCGAATTGTCCGGTCCTCTGTTGT
CDV-RPA-P CTTGGCATCACCAAGGAGGAAGCTCAGCTGG(FAM-dT)
(THF)(BHQ1- dT)CAGAAATAGCATCCA-C3spacer
\