Skip to main content

Table 1 Selected virulence-associated genes and their corresponding primer pairs

From: OmpA protein sequence-based typing and virulence-associated gene profiles of Pasteurella multocida isolates associated with bovine haemorrhagic septicaemia and porcine pneumonic pasteurellosis in Thailand

No Gene symbol Function Primer name Primer sequence (5′ ➔ 3′) Product size (kb) References
1 exbB Energy transport for iron acquisition exbB-F
exbB-R
TTGGCTTGTGATTGAACGC
TGCAGGAATGGCGACTAAA
283 [18]
2 exbD Energy transport for iron acquisition exbD-F
exbD-R
CGTTCTGATTACAGCCTCTT
AACGAAATCTTGGAAACTGG
247 [18]
3 fimA Adherence and colonization fimA-F
fimA-R
CCATCGGATCTAAACGACCTA
AGTATTAGTTCCTGCGGGTG
806 [18]
4 fur Iron-dependent regulation fur-F
fur-R
GTTTACCGTGTATTAGACCA
CATTACTACATTTGCCATAC
244 [18]
5 hgbA Iron acquisition hgbA-F
hgbA-R
TCAACGGCAGATAATCAGGG
GCGGGAATGCTGAAGATAAG
268 [18]
6 hgbB Iron acquisition hgbB-F
hgbB-R
ACCGCGTTGGAATTATGATTG
CATTGAGTACGGCTTGACAT
768 [33]
7 hsf1 Adherence and colonization hsf1-F
hsf1-R
TTGAGTCGGCTGTAGAGTTCG
ACTCTTTAGCAGTGGGGACAACCTC
654 [18]
8 hsf2 Adherence and colonization hsf2-F
hsf2-R
ACCGCAACCATGCTCTTAC
TGACTGACATCGGCGGTAC
430 [18]
9 nanB Nutrition acquisition nanB-F
nanB-R
GTCCTATAAAGTGACGCCGA
ACAGCAAAGGAAGACTGTCC
586 [33]
10 nanH Nutrition acquisition nanH-F
nanH-R
GTGGGAACGGGAATTGTGA
ACATGCCAAGTTTGCCCTA
287 [18]
11 oma87 Outer membrane protein assembly and insertion oma87-F
oma87-R
GGCAGCGAGCAACAGATAACG
TGTTCGTCAAATGTCGGGTGA
833 [18]
12 ompA Outer membrane biosynthesis and integrity ompA-F
ompA-R
CGCATAGCACTCAAGTTTCTCC
CATAAACAGATTGACCGAAACG
202 [18]
13 ompH Outer membrane general transport ompH-F
ompH-R
CGCGTATGAAGGTTTAGGT
TTTAGATTGTGCGTAGTCAAC
452 [18, 33]
14 pfhA Adherence and colonization pfhA-F
pfhA-R
AGCTGATCAAGTGGTGAAC
TGGTACATTGGTGAATGCTG
256 [33]
15 plpB Amino acid transport plpB-F
plpB-R
TTTGGTGGTGCGTATGTCTTCT
AGTCACTTTAGATTGTGCGTAG
531 [18]
16 pmHAS Capsule biosynthesis pmHAS-F
pmHAS-R
TCAATGTTTGCGATAGTCCGTTAG
TGGCGAATGATCGGTGATAGA
430 [18]
17 psl Outer membrane biosynthesis and integrity psl-F
psl-R
TCTGGATCCATGAAAAAACTAACTAAAGTA
AAGGATCCTTAGTATGCTAACACAGGACGACG
400 [33]
18 ptfA Adherence and colonization ptfA-F
ptfA-R
TGTGGAATTCAGCATTTTAGTGTGTC
TCATGAATTCTTATGCGCAAAATCCT GCTGG
500 [18, 33]
19 sodA Detoxification of radicals sodA-F
soda-R
TACCAGAATTAGGCTACGC
GAAACGGGTTGCTGCCGCT
263 [33]
20 sodC Detoxification of radicals sodC-F
sodC-R
AGTTAGTAGCGGGGTTGGCA
TGGTGCTGGGTGATCATCATG
237 [33]
21 tadD Adherence and colonization tadD-F
tadD-R
TCTACCCATTCTCAGCAAGGC
ATCATTTCGGGCATTCACC
418 [18]
22 tbpA Iron acquisition tbpA-F
tbpA-R
TGCGACAACGGAAATTTCCTC
GGACAGTGCATATAACTTGTTTACTA
808 [33]
23 tonB Energy transport for iron acquisition tonB-F
tonB-R
CGACGGTGAAACCTGAGCCA
CCGAGCGATAAGCATTGACT
261 [18]
24 toxA Exotoxin toxA-F
toxA-R
CTTAGATGAGCGACAAGGTT
GGAATGCCACACCTCTATA
864 [33]
25 plpE Highly immunogenic outer membrane lipoprotein plpE-F
plpE-R
CCATGGGCATGAAACAAATCGTTTTAAA
CTCGAGTTGTGCTTGGTGACTTTTTTC
1010 [27]