Skip to main content

Table 1 Primer design

From: chTLR4 pathway activation by Astragalus polysaccharide in bursa of Fabricius

Names of primers Sequences(5′-3′) Product length Accession no.
chTLR4 TTCCAAGCACCAGATAGCAACATC 202 NM_001030693.1
ACGGGTCACAGAAGAACTTAGGG
chMyD88 AGCGTGCCAAAGACTTCAGA 251 NM_001030962.3
ACCATCCTCCGACACCTTCT
chTRIF AGCCTGATGGAGAGAGACAGAG 139 NM_001081506.1
GATAGACGAGAGGAACTGACCTG
chNF-κB TCTGAACAGCAAGTCATCCATAACG 255 NM_205134.1
AAGGAAGTGAGGTTGAGGAGTCG
chIRF3 CTCTCTGACTCTTTCAACCTCTTCG 260 NM_205372.1
TGCTGCCTGCTCCTGTGG