Skip to main content

Table 1 Primers for qPCR

From: Revelation of mRNAs and proteins in porcine milk exosomes by transcriptomic and proteomic analysis

ID Primer Sequences (5’to3’) Products length (bp)
ENSSSCG00000000207 LOC100739053-F CAAAGGAAGCCTACAAGAA 198
LOC100739053-R CACGGTAGTCCAGCAGA
ENSSSCG00000003930 RPS8-F GAGAAAGCCCTACCACA 191
RPS8-R CGTCAATAATCCTCGTCT
ENSSSCG00000004489 EF1ALPH-F GATTGTTGCTGCTGGTGT 226
EF1ALPH-R TGCTACTGTATCAGGGTTGT
ENSSSCG00000004177 RPS12-F TCTACCCGTAACCCACC 219
RPS12-R CCTCCACCAACTTGACATA
ENSSSCG00000015103 RPS25-F GCCCAAGGACGACAA 109
RPS25-R GCCTTTGGACCACTTC
ENSSSCG00000006249 RPS20-F ACCGCTGTTCGCTCTTC 211
RPS20-R GTCCCTTCACTTTGAGGTTCT
ENSSSCG00000029830 RPL8-F CGAGCGACACGGCTACAT 255
RPL8-R GGCTTCTCCTCCAGACAACAC
ENSSSCG00000009267 CSN3-F CACCTGAGACCACCACT 140
CSN3-R TGACTGAAGGCAGATAA
ENSSSCG00000013907 UBA52-F ACGGGCAAGACCATCAC 196
UBA52-R GCAGACGAAGCACCAAGT
ENSSSCG00000001502 RPS18-F AGGGTGTAGGACGGAGAT 134
RPS18-R CTTGTATTGGCGAGGATT
ENSSSCG00000024825 RPL6-F CAGAGGCAAGAGGGTCA 128
RPL6-R TGGTGGAGGTGGCAATA
ENSSSCG00000004970 RPLP1-F GCACGACGATGAGGTTAC 131
RPLP1-R TGAGGCTCCCGATGTT
ENSSSCG00000010328 RPS24-F TTGATGTCCTTCACCCTG 269
RPS24-R CATTCTGTTCTTGCGTTCT
ENSSSCG00000025527 FABP3-F GCTGGGATTGAAGTTTGA 163
FABP3-R GTGGGTGAGTGTCAGGATG
5S 5S–F TCTACGGCCATACCACCCTGAA 83
5S–R GGCCCGACCCTGCTTAG