Skip to main content

Table 1 Primer sequences for T. circumcincta SNPs 167 and 198/200, and T. colubriformis SNP 198/200, and sequence primers for both species

From: Quantification of resistant alleles in the β-tubulin gene of field strains of gastrointestinal nematodes and their relation with the faecal egg count reduction test

Primer name Sequence 5′-3′ Modifications Expected product size (pb) Tm (°C)
T. circumcincta
 Tc SNP200 F CACTCTTTCTGTACACCAATTG [Btn]5 128 60
 Tc SNP200 R AGTGATTGAGATCGCCATAA -
 Tc SNP167 F CAAAATTCGCGAGGAGTAT - 276 60
 Tc SNP167 R TTCTACCAATTGGTGTACAGAAAG [Btn]5
T. colubriformis
 Tri SNP200 F TACTTTATCAGTCCATGAGCTGG [Btn]5 128 62
 Tri SNP200 R ATGGTTGAGATCTCCATAGGTTG -
Sequencing
 Tc 200 Seq AGAGCTTCATTATCGATG - - 60
 Tc 167 Seq CGGATAGAATCATGGCT - - 60
 Tri 200 Seq AGAGCTTCGTTATCGATGCA - - 62