Skip to main content

Table 1 Sequences of primers used for ESBL gene detection

From: Characteristics of extended-spectrum β-lactamase–producing Escherichia coli isolated from fecal samples of piglets with diarrhea in central and southern Taiwan in 2015

PCR target primer Sequences (5’–3’) Annealing Tm (°C) Predicted PCR size (bp) Reference
bla TEM TEM-F TCGGGGAAATGTGCGCG 55 972 [37]
TEM-R TGCTTAATCAGTGAGGCACC    
bla SHV SHV-F GCCTTTATCGGCCCTCACTCAA 54 819 [38]
SHV-R TCCCGCAGATAAATCACCACAATG    
bla CTX-M-1-group CTX-M-1-F CCCATGGTTAAAAAATCACTGC 54 942 [39]
CTX-M-1-R CAGCGCTTTTGCCGTCTAAG    
bla CTX-M-2-group CTX-M-2-F CGACGCTACCCCTGCTATT 52 552 [40]
CTX-M-2-R CCAGCGTCAGATTTTTCAGG    
bla CTX-M-8-group CTX-M-8-F CAAAGAGAGTGCAACGGATG 52 205 [40]
CTX-M-8-R ATTGGAAAGCGTTCATCACC    
bla CTX-M-9-group CTX-M-9-F ATGGTGACAAAGAGAGTGCAAC 55 876 [26]
CTX-M-9-R TTACAGCCCTTCGGCGATGATT    
bla CTX-M-25-group CTX-M-25-F GCACGATGACATTCGGG 52 327 [40]
CTX-M-25-R AACCCACGATGTGGGTAGC    
\