Skip to main content

Table 2 Primers used for this study

From: Infectious keratoconjunctivitis in wild Caprinae: merging field observations and molecular analyses sheds light on factors shaping outbreak dynamics

Primer Sequence (5′-3′) Positiona Use Reference
Serstart3 TTTAGTAGACTCCACTTCACC 3731–3751 PCR Belloy et al. [26]
Serstart2 CACTATACTTAACAGATAGTCC 3781–3802 Nested PCR, Sequencing Mavrot et al. [4]
Serstart0 ATACTCAAAGTGGAAATAATGGAA 3979–4002 Sequencing This study
Serend0 GCAACAACAATAGTAAGAGCAG 4743–4764 Sequencing This study
lppTA2 TTTGATCTCTCCACCTTCAGC 5113–5093 PCR Mavrot et al. [4]
lppTA GGCACTAATAGTGCGTAATTC 5065–5045 Nested PCR Mavrot et al. [4]
  1. aPosition with reference to nucleotide sequence of lppS and lppT of M. conjunctivae HRC/581 T (GenBank accession number AJ318939)