Skip to main content

Table 3 List of primers used for detection of genes specificto different SPI

From: Homologous prime-boost immunization with live attenuated Salmonella enterica serovar Senftenberg and its preventive efficacy against experimental challenge with various strains of S. Senftenberg

SPI Primers Sequence 5'–3' Amplicon Size (bp)
SPI1 invAE F CAGCGATATCCAAATGTTGC 2168
  invAE R AAATGGCAGAACAGCGTCGTA  
  hilA F CTGCCGCAGTGTTAAGGATA 497
  hilA R CTGTCGCCTTAATCGCATGT  
  avr F AGACTTATATTCAGCTATCC 1115
  avr R ACATAACCCTGCTGTACCTG  
SPI2 aa permease F ACCATTCAAGAGACAATTGG 1737
  aa permease R GTCCTGTTCTGGTATTACGC  
SPI3 mgtC F ATGAATCCCCAAAATTAAGG 1153
  mgtC R AATCATCTGGCAAGTTAACG  
SPI4 ABC Trans F CAGTCTATCACAGCAAGGCA 1409
  ABC Trans R TTATCCGGAGAACAATCACG  
SPI5 pipB F AATATTGGATGGGGGAAAAG 230
  pipB R AACCTGACTCACGCAGACCT