Skip to main content

Table 5 N gene based primers set used in detection of PPRV by RT-LAMP assay

From: Genetic detection of peste des petits ruminants virus under field conditions: a step forward towards disease eradication

Primer ID Type Sequence (5ˊ to 3ˊ) Position*  Length (bases) Predicted length of amplified segment
PPRV F3 Forward outer ACATCAACGGGTCAAAGCT 295–313 19 187 bp
PPRV B3 Backward outer ACTCGAGGGTCCTTCAGTTG 521–502 20
PPRV/FIP Forward inner (F1c + F2) CCGCTGTATCAATTGCCCGGGTTTTCGGCGTGATGATCAGCATG 376–357/317–335 44
PPRV/BIP Backward inner (B1 + B2c) GCATCCGCCTTGTTGAGGTAGTTTTTTTGTCCAAATCAGCACCACG 400–421/481–462 46
  1. *The position of primers is indicated as per sequence position of complete genome of PPRV (Accession #hq197753)