Skip to main content

Table 1 Oligonucleotide primer and probe sequences with their respective reporter dye and quencher used in this study

From: A novel multiplex qPCR targeting 23S rDNA for diagnosis of swine dysentery and porcine intestinal spirochaetosis

Primer or probe name Target Concentration Sequence 5′→3′ Amplicon
Multiplex qPCR
 Primer for 23S rDNA 0.4 μM TTCGATGGAATGACACAGATTGT 128 bp
 Primer rev 23S rDNA 0.4 μM CCGAAAGCCCAGTCACTATC
 Probe_hyo B.hyodysenteriae 100 nM 6-FAM-CCTTAACCTTAAAGAAGCAAGCAT(BHQ-1)TTGACTCACCTCAAG-SpacerC3  
 Probe _pilo B.pilosicoli 100 nM Yakima Yellow-AGGTGATGGTTATCCTCGTCGAAT-BHQ-1  
 Probe_
apathogen
B. intermedia/
B. innocens/
B. murdochii
25 nM Dragonfly Orange-CCTCAACCTTAAAGCAACAAGCAT(BHQ-2)TTTACTCATCACAAG-SpacerC3  
 eGFP for enhanced GFP 0.2 μM GACCACTACCAGCAGAACAC 177 bp
 eGFP rev enhanced GFP 0.2 μM GAACTCCAGCAGGACCATG
 Probe_eGFP enhanced GFP 25 nM ATTO 647N-AGCACCCAGTCCGCCCTGAGCA-BHQ-3  
Duplex PCR [12]
B.hyo_for nox 0.5 μM ACTAAAGATCCTGATGTATTTG 345 bp
B.hyo_rev nox 0.5 μM CTAATAAACGTCTGCTGC
B.pilo_for 16S rDNA 0.17 μM AGAGGAAAGTTTTTTCGCTTC 823 bp
B.pilo_rev 16S rDNA 0.17 μM GCACCTATGTTAAACGTCCTTG