Skip to main content

Advertisement

Table 2 The list of primer sequences used for amplification of qRT-PCR

From: Lipopolysaccharide derived from the digestive tract triggers an inflammatory response in the uterus of mid-lactating dairy cows during SARA

Gene Forward primers Reverse primers Accession number Product size (bp)
TLR-4 GGACCCTTGCGTACAGGTTG GGAAGCTGGAGAAGTTATGGC NM_174198.6 244
TRAF-6 GCGGCCTTCAAGTTAGGAGA TCATCAACTGCTCGTTCGGG NM_001034661.2 141
NF-κB ACGATCGTCACCGGATTGAG GGTGCTGAGAGATGGCGTAA XM_005699996.1 194
β-actin CTCTTCCAGCCTTCCTTCCT GGGCAGTGATCTCTTTCTGC AY141970 178
IL-6 GGAGGAAAAGGACGGATGCT GGTCAGTGTTTGTGGCTGGA EU276071.1 226
IL-8 CCTCTTGTTCAATATGACTTCCA GGCCCACTCTCAATAACTCTC NM_173925.2 170
TNF-α GCTCTTACCGGAACACTTCG GGACACCTTGACCTCCTGAA NM_173966 238
IL-1β AACCGAGAAGTGGTGTTCTGC TTGGGGTAGACTTTGGGGTCT NM_174093 167
MyD88 AAAGCCCGAGTGTTTTGATG TCACATTCCTTGCTTTGCAG NM_001014382 234
LBP GCAAGATCACTGGATTCTTGGA AAAACAGGAAGTCCTTGTGGATC NM_001038674.2 228