Skip to main content

Table 1 Primer pairs of DNA sequences for used proteins (or polypeptide fragments) and their expected molecular weight including HisTag

From: A proteomic approach to the development of DIVA ELISA distinguishing pigs infected with Salmonella Typhimurium and pigs vaccinated with a Salmonella Typhimurium-based inactivated vaccine

Protein Forward primer 5′-3′ Reverse primer 5′-3′ Expected protein molecular weight
BamB ATGCAATTGCGTAAATTACTTCTGCC TTAACGCGTAATCGCGTAGACC 45.8 kDa
FliC-frag ACGCTGAATGTGCAACAAAAATATAAGGTC ACCTTCGGCTTTACTTGCAGCG 25.8 kDa
MetQ ATGGCGTTCAAATTCAAAACCTTTGCGG TTACCAGCCTTTCACCGCGCC 33.3 kDa
PrgI ATGGCAACACCTTGGTCAGGCTATC TTAACGGAAGTTCTGAATAATGGCAGCATC 12.7 kDa
SipC ATGTTAATTAGTAATGTGGGAATAAATCCCGCC TTAAGCGCGAATATTGCCTGCGAT 46.8 kDa
SipD ATGCTTAATATTCAAAATTATTCCGCT TTATCCTTGCAGGAAGCTTTT 41.0 kDa
SseB ATGTCTTCAGGAAACATCTTATGGGGAA TCATGAGTACGTTTTCTGCGCTATC 25.4 kDa
SurA ATGAAGAACTGGAAAACGCTGCTTC TTAGTTACTCAAAATCTTAACGTAAGCGCTG 51.1 kDa
SipB ATGGTAAATGACGCAAGTAGCATTAGCCG TTATGCGCGACTCTGGCGCAGAATAAAAC 66.3 kDa
OppA ATGTCTAACATCACGAAAAAAAGTTTG TTAATGTTTGATAATATATAAGTTTTTCACATAAAT 65.1 kDa