Skip to main content

Table 4 Primers used in the present study

From: Iron-regulated gene ireA in avian pathogenic Escherichia coli participates in adhesion and stress-resistance

Primers Primer sequence (5′–3′) Gene Reference
ireA-F AGATACGCTTGTTGTTAC ireA This study
ireA-R CATTCCATGCTGCTAC   
ireAMu-F GTAAATTCCCTCTTTGCTAACGCAAATCATTATCATTACGCCTTTGGCAAAGGGAAATTTGTGTAGGCTGGAGCTGCTTCGA Upstream region of ireA This study
ireAMu-R CATTACTGATTACTACACTGGTACCTGAGGCTCACGGCCTCAGGTTGTCTTTATATACTCCATATGAATATCCTCCTTAG Downstream region of ireA  
ireA-1 TACTCCCCATCCCCGGGCAA ireA This study
ireA-2 GGGGGCAGCAATATCCGGTG   
k1 CAGTCATAGCCGAATAGCCT kanR [27]
k2 CGGTGCCCTGAATGAACTGC
ireACo-F TACGGATCCCTGAACAATAGCGAT ireA This study
ireACo-R GCTAAGCTTTTACAACCTGGAAAC   
QireA-F AAACATGGGATGGCGTACTT ireA This study
QireA-R AATCAATGGGCCTGACAGATAG   
QFeoB-F GCACTCTTTGTGCATGGTATTC FeoB This study
QFeoB-R TGGCAGCACGGTGTTAAT   
QfepA-F CAATGCGCCAGAACATAAAGAG fepA This study
QfepA-R TGTCGAGGTTGCCATACAAG   
QfepC-F TCGTTACGCCAGCCATTT fepC This study
QfepC-R TGCAGCGCAGACCATAAA   
QfyuA-F ATGCCTATGTGGGATGGAATG fyuA This study
QfyuA-R CCAGTCATCGGTGGTGTATTT   
Qirp1-F GGCGAACCCTGCTATGTATT irp1 This study
Qirp1-R GTCCATGCAGTACCAGCTAAA   
Qirp2-F GCGGCTGATTACCAACAATTAC irp2 This study
Qirp2-R CTGGATCAGGTTGCTCTCTTC   
QChuA-F TAGGCCACATCAAGGCTAAAC ChuA This study
QChuA-R CGGCGACAACTATGTCGTATAA   
QdnaE-F ATGTCGGAGGCGTAAGGCT dnaE This study
QdnaE-R TCCAGGGCGTCAGTAAACAA   
P1 TTGCCGGAATTCTCAGGGGGCCA
GTCTACTGAATGAG
fusion ireA This study
P2 ACCGTCGTCGACTTAGTGATGATGATGAT
GATGAGAACCATACAGGGAAGACATAGGG
  
QyfcO-F TGCATAACTCGTCATGTCCTGTCTCCGTTG yfcO This study
QyfcO-R AGCGTTTTCTCAATCGTTCCGCCCGTC   
QyfcQ-F CCTGCATTTCTACGGCAATTTAC yfcQ This study
QyfcQ-R CGGTCACCATCAGGTCTTTAC   
QaufG-F TGCTCTGGCAACATCAGTAG aufG This study
QaufG-R ACTAACAGGTAAAGTCAGGAAAGT   
QfmlD-F CAGGCTCCCTACAGTCATATAAAG fmlD This study
QfmlD-R TCGGTGTCTTATCACCAATATCC   
QfmlE-F CAGTGCCAGACAATTTCCAAC fmlE This study
QfmlE-R CCGTTAAATGCAACCTGAACTC   
QyadN-F CCACTGTTAATGGCGGTGTA yadN This study
QyadN-R TTTAGCCAGGCGAGAAGAAC   
QfimH-F CTTATGGCGGCGTGTTATCT fimH This study
QfimH-R CGGCTTATCCGTTCTCGAATTA