Skip to main content

Advertisement

Table 3 Primers used in conventional PCR assays

From: New insight into dolphin morbillivirus phylogeny and epidemiology in the northeast Atlantic: opportunistic study in cetaceans stranded along the Portuguese and Galician coasts

Primer Target gene Sequence (5′–3′) (sense) Tm Genome position Reference
CeMV-He1 H CRTTGATACTYGTGGGTGTG (+) 59 7194–7213 [15]
CeMV-He2 H TGTTAACTTCTGGGGCATCC (−) 59 7407–7426
DMVFu-F F GGCACCATAATTAGCCAGGA (+) 51 6483–6502
DMVFu-R F GCCCAGATTTGTGCCTACAT (−) 51 6655–6674
DMV-C P ATGTTTATGATCACAGCGGT (+) 51 2132–2151 [35]
DMV-P2 P ATTGGGTTGCACCACTTGTC (−) 51 2541–2560
NgeneF N CCHAGRATYGCTGAAATGATHTGTGA (+) 48 849–874 [14]
NgeneR N AACTTGTTCTGRATWGAGTTYTC (−) 48 1056–1078