Skip to main content

Table 3 Primers used in conventional PCR assays

From: New insight into dolphin morbillivirus phylogeny and epidemiology in the northeast Atlantic: opportunistic study in cetaceans stranded along the Portuguese and Galician coasts

Primer Target gene Sequence (5′–3′) (sense) Tm Genome position Reference
CeMV-He1 H CRTTGATACTYGTGGGTGTG (+) 59 7194–7213 [15]
DMV-C P ATGTTTATGATCACAGCGGT (+) 51 2132–2151 [35]