Skip to main content

Table 2 Sequences and locations of c-kit primers used in this study

From: Identification of the two KIT isoforms and their expression status in canine hemangiosarcomas

Designation Sequence (5′-3′) Primer location
1F CGATGAGAGGCGCTCGC 27–34
1R GGCGTAACACA TGAACACTCCAG 891–913
2F GCTGGCATCATGGTGACTTC 819–838
2R CATGGGTTTCTGTAGATACTTGTAGG 1668–1693
3F CACACCTTTGCTGATTGGCT 1591–1610
3R GATTCGACCATGAGTAAGGAGG 2419–2440
4F GGGTATGGCATTCCTGGC 2359–2376
4R GCTTCACACATCTTCGTGTACCA 2937–2959
AF GCTCAGAGTCTATCGCAGCCACCG 3–26
AR CTGCCTTCTCTGTGATCCATTCGTTG 271–296
BF GCTGTCCAAGAAATTCACCCTG 619–640
BR ATATTACTTTCATTGTCAGACTTGGG 1124–1149
CF AAAACTCGTCTCTGTCACCGTCTG 1422–1445
CR GATCTCCTCAACAACCTTCCACTG 1691–1714
DF AAATCAGAGTTAATAGTCAGTGTCGG 133–158
DR TTTATCCACATCGAGTCCACG 729–749
EX9F CAACAATGTAGGCAGGAGTTCTG 1495–1517
EX9R CAGCAAAGGTGTGAACAGGG 1572–1591
  1. F forward, R reverse
  2. Annealing temperature dependent on combination of the primers: 55 °C for 1F and 1R, 56 °C for 2F and 2R, 52 °C for 3F and 3R, 61 °C for AF and AR, 54 °C for BF and BR, 57 °C for CF and CR, 54 °C for DF and DR, 57 °C for AF and BR, 55 °C for P2F and CR, 56 °C for CF and P3R, and 54 °C for EX9F and EX9R