Skip to main content

Advertisement

Table 1 Conditions used for the RT-PCR

From: Isolation and characterization of porcine epidemic diarrhea virus associated with the 2014 disease outbreak in Mexico: case report

ID Gene Sequence Position Tm °C Amplicon size
PEDVF (1) Sa TTCTGAGTCACGAACAGCCA 1,466 55 651
PEDVR (1) Sa CATATGCAGCCTGCTCTGAA 2,097 55 651
MPED2F (2) Mb AGTCTTACATGCGAATTGACC 2,565 55 681
MPED2R (2) Mb AGCTGACAGAAGCCATAAAGT 2,398 55 681
  1. a[20], b[21]