Skip to main content

Table 2 The primer sequences of target and internal reference genes used in qPCR

From: Rumen-derived lipopolysaccharide enhances the expression of lingual antimicrobial peptide in mammary glands of dairy cows fed a high-concentrate diet

Gene Forward primer Reverse primer GenBank accession PCR products
LAP AGGCTCCATCACCTGCTCCTT CCTGCAGCATTTTACTTGGGCT AY911374.1 183 bp
BNBD5 CTGGATCACCTGCTCCTCGT GGTGCCAATCTGTCTCATGTTG NM_001130761.1 150 bp
IL-1β GGCCAAAGTCCCTGACCTCT CTGCCACCATCACCACATTC NM_174093.1 167 bp
IL-6 GGAGGAAAAGGACGGATGCT GGTCAGTGTTTGTGGCTGGA NM_173923.2 227 bp
IL-8 CCTCTTGTTCAATATGACTTCCA GGCCCACTCAATAACTCTC NM_173925.2 170 bp
TNF-α CTTCTGCCTGCTGCACTTCG GAGTTGATGTCGGCTACAACG AF_348421.1 156 bp
NF-kB ATACGTCGGCCGTGTCTAT GGAACTGTGATCCGTGTAG NM_001045868.1 129 bp
GAPDH GGGTCATCATCTCTGCACCT GGTCATAAGTCCCTCCACGA XM_001252479 177 bp