Skip to main content

Table 1 Primers used in this study

From: Characterization of common carp (Cyprinus carpio L.) interferon regulatory factor 5 (IRF5) and its expression in response to viral and bacterial challenges

Primer Sequence (5′-3′) Application GenBank No.
IRF5-F
IRF5-R
GCAAGTACCAGGAAGGAG
AAATCAGTTAAGGGCAACA
Homologous amplification  
IRF5-3 F1
IRF5-3 F2
IRF5-5R1
IRF5-5R2
IRF5g1-F
IRF5g1-R
GTCACTCATTCTGTAGGCCCT
GCAGAGAACCAGGTTCATCC
TGTCCTTCGTGCCATCGTAGTG
GTTTAGGGCACAGCGGAGATT
CAGCACCATGAGTGGTCAACCACG
AATATAGAGTTCTCCTCCTCCAG
First round 3′-RACE PCR
Nested 3′-RACE PCR
First round 5′-RACE PCR
Nested 5′-RACE PCR
For the first intron
IRF5g2-F
IRF5g2-R
AGGACTGCACTGGCTCAATCAAGA
ATCTACTCCTTCCTGATACTTGCCT
For the second intron
IRF5g3-F
IRF5g3-R
ATGGAAAGCCAATCTCCGCTGTG
GTAACATGAGCGGACTGCTCAGC
For the third, fourth and fifth intron
IRF5g4-F
IRF5g4-R
AGTGCAATCAAAGTTGAGCAGGCA
ATGATCGGTATAGAACCTCTGCTT
For the sixth intron
IRF5g5-F
IRF5g5-R
ACGCCATCAGGCTGTGCCAGTGTA
CAATGATGAGCTTTTTCTCCTTG
For the seventh intron
IRF5g6-F
IRF5g6-R
GCTTCGGTGAGGACTGGCCAGACA
ACTCTGCAGAAGTCTGTGGAGCT
For the eighth intron
IRF5-rF
IRF5-rR
CCTGGGCTCAGAACATCCACTAAC
AGTATGGCATCATAGAGGGCACCT
Real-time PCR  
TNFα-F
TNFα-R
ACAGGTGATGGTGTCGAGGAGGA
TCTGAGACTTGTTGAGCGTGAAG
Real-time PCR JF957372
S11-F
S11-R
CCGTGGGTGACATCGTTACA
TCAGGACATTGAACCTCACTGTCT
Real-time PCR AB012087
ISG15-F GTGAGCGGTGAAGCCACAGTTG Real-time PCR KP115358
ISG15-R GCGAACCGTTATCGGCAGACAG   
PKR-F AGGCTTGATCCACAGAGACCTGAA Real-time PCR JX516101
PKR-R CGTTCCAGAAGTTGCACGTCATTG