Skip to main content

Advertisement

Table 1 Synthesized siRNAs sequences targeting the regions of PRRSV nsp11 and the primers of ORF-7 for RT-PCR

From: Nonstructural protein 11 (nsp11) of porcine reproductive and respiratory syndrome virus (PRRSV) promotes PRRSV infection in MARC-145 cells

Gene of target Name of siRNA Location(bp) Sequence (5’-3’)
nsp 11 nsp11 siRNA 1 244-262 CGTGTCATACTATCTCACA
nsp 11 nsp11 siRNA 2 526-544 CACACTGACAGATGTGTAC
nsp 11 nsp11 siRNA 3 409-427 CACTACCGTTGGAGGATGT
Negative control Control siRNA   CCTACGCCACCAATTTCGT
ORF-7 For    AAACCAGTCCAGAGGCAAGG
ORF-7 Rev    GCAAACTAAACTCCACAGTGTAA
GAPDH For    TGACAACAGCCTCAAGATCG
GAPDH Rev    GTCTTCTGGGTGGCAGTGAT