Skip to main content

Table 3 Primers used for reverse transcriptase-polymerase chain reaction of immortalized canine oral fibrosarcoma cell lines

From: Antiproliferative effects of masitinib and imatinib against canine oral fibrosarcoma in vitro

Target Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′) Spanned mRNA sequence Product size (bp)
PDGFRA CCTCGATCCTTCCAAATGAA GGTCACAAAAAGGCCACTGT 357-523 167
PDGFRB GTGGTATGGGAACGGTTGTC GTGGGATCTGGCACAAAGAT 228-421 194
KIT CCCATTTAACCGAACGAGAA TCTCCGTGATCTTCCTGCTT 2016-2226 211
KDR GATCGGTGAGAAATCCCTGA CTGGAAGTCATCCACGTTT 1266-1473 208