Skip to main content

Table 1 Oligonucleotide primers used for detection of A. phagocutophilum

From: Evaluation of different nested PCRs for detection of Anaplasma phagocytophilum in ruminants and ticks

Target gene Primer name Primer Sequence (5’-3’) Annealing temp (°C) Amplicon size (bp) Reference
16S rRNA ge3a CACATGCAAGTCGAACGGATTATTC 55 932 [25]
  ge10r TTCCGTTAAGAAGGATCTAATCTCC   
  ge9f AACGGATTATTCTTTATAGCTTGCT 55 546
  ge2 GGCAGTATTAAAAGCAGCTCCAGG   
Msp4 MAP4AP5 ATGAATTACAGAGAATTGCTTGTAGG 54 849 [24, 27]
  MSP4AP3 TTAATTGAAAGCAAATCTTGCTCCTATG   
  msp4f CTATTGGYGGNGCYAGAGT 55 381
  msp4r GTTCATCGAAAATTCCGTGGTA   
16S rRNA EE-1 TCCTGGCTCAGAACGAACGCTGGCGGC 50 1433 [23]
  EE-2 AGTCACTGACCCAACCTTAAATGGCTG   
  EE-3 GTCGAACGGATTATTCTTTATAGCTTGC 50 926
  EE-4 CCCTTCCGTTAAGAAGGATCTAATCTCC   
groEL EL(569)F ATGGTATGCAGTTTGATCGC 62 624 [26, 34]
  EL(1193)R TCTACTCTGTCTTTGCGTTC   
  EL(569)F ATGGTATGCAGTTTGATCGC 56 573
  EL(1142)R TTGAGTACAGCAACACCACCGGAA   
16S rRNA EC9 TACCTTGTTACGACTT 55 1462 [35]
  EC12a TGATCCTGGCTCAGAACGAACG   
  SSAP2f GCTGAATGTGGGGATAATTTAT 55 641
  SSAP2r ATGGCTGCTTCCTTTCGGTTA