Skip to main content

Table 1 Primers for semi-quantitative real time RT-PCR analyses

From: Biochemical and molecular investigation of thermal manipulation protocols during broiler embryogenesis and subsequent thermal challenge

Gene Sequence (5′- 3′)
GAPDH GTGTTATCATCTCAGCTCCCTCAG GGTCATAAGACCCTCCACAATG
Atrogin1 CGCAAACGGCTAATCCTATCT CTTCCGTGGGTAACACCTTATG
CK TCTGGCACAACGACAACAA CCGGAAGACCTCCTTCATATTTC
avUCP GCCCGCAACTCCATCATTA GGGACGTTGTCTGTCATCAG
DIO3 GCAGAAGCTGGACTTCTTCA CTGCCGAAGTTGAGGATGAG
DIO2 GGCTGACTTTCTGTTGGTCTAC CTTCCTGATTCCTGTGCTTCTT