Skip to main content

Table 2 Primer pairs for target genes used in this study

From: Analysis of zebrafish (Danio rerio) behavior in response to bacterial infection using a self-organizing map

Bacteria Target gene Product size (bp) Nucleotide sequence (5’ to 3’) Reference
E. tarda gyrB1 415 F: GCATGGAGACCTTCAGCAAT [70]
R: GCGGAGATTTTGCTCTTCTT
A. hydrophila 16S rDNA 685 F: GAAAGGTTGATGCCTAATACG [71]
R: CGTGCTGGCAACAAAGGA