Skip to main content

Table 1 PCR primers used in this study

From: A porcine reproductive and respiratory syndrome virus (PRRSV) vaccine candidate based on the fusion protein of PRRSV glycoprotein 5 and the Toll-like Receptor-5 agonist Salmonella Typhimurium FljB

Primer name Primer sequence (5′ → 3′) Application
GP5-ORF F ACTTAAGCTTGGTACCATGG Amplification of GP5 ORF
GP5-ORF R CGCTAGAGCGCTGGCAAGTG Amplification of GP5 ORF
GP5a F CCGGGATCCAACGCCAGCGACAACAAC Amplification of GP5a fragment
GP5a R CACCGCCGCTTCCACCGCCACCCTCCACTGCCCAGTCAAA Amplification of GP5a fragment
GP5b F GTGGAAGCGGCGGTGGCGGAAGCTGCATGTCCTGGCGCTA Amplification of GP5b fragment
GP5b R CCGGAATTCGAGACGACCCCATAGTTCCGCT Amplification of GP5b fragment
fljB F GGGGGAATTC GGTGGCGGTGGTTCTATGGCACAAGTAATCAACACTAACAGT Amplification of fljB fragment
fljB R GCGTCGACTTAACGTAACAGAGACAGC Amplification of fljB fragment