Skip to main content

Table 1 Primers used for identifying and completely sequencing the TGEV-HX strain

From: Molecular characterization and phylogenetic analysis of transmissible gastroenteritis virus HX strain isolated from China

Primer Sequence 5′-3′ Position
TGEV-NF TCATGCAGATGCCAAATTTAAAGA 27,213-27,236
TGEV-NR TCATCCTTCTTGTTATTGAATTGT 27,456-27,479
PEDV-NF TTTCTAAGGTACTTGCAAATAATG 26,382-26,405
PEDV-NR TTGGAGATCTGGACCTGTTGTTGC 26,757-26,780
P1 ATGAGTTCCAAACAATTCAAGA 315-336
P2 ATCAAA ACATCCAAAGCACCCT 4,318-4,339
P3 AATTCA AAGTCCTAA AAACGAT 4,250-4,271
P4 GCGTAGATGATCATA AAGAACG 8,470-8,491
P5 CATTGTCACCCTTGTTGTGAAC 8,420-8,441
P6 GTAGATGTCAAA AGCTCTACTA 12,400-12,421
P7 TCTATGCAGAGTTTTACTGTTG 12,300-12,321
P8 TAATGAATTTATGCTTTGTTCC 15,200-15,221
P9 AGGCATGTGTGTAGTATGTGGT 15,100-15,121
P10 AAGCTTAGCAAA AGCTCTT 18,169-18,187
P11 CGCACTCGCTCTAAATTGTCTT 18,080-18,101
P12 ACTACGTTTAACCGTTGTCTGT 20,660-20,681
P13 ATGAAA AAACTATTTGTGG 20,365-20,383
P14 TTA ATGGACGTGCACTTTT 24,690-24,708
P15 GCTGTGGATGCATAGGTTGTTT 24,608-24,629
P16 TTGGAGGGTTATGGGGTTGAAG 27,021-27,042
P17 CTTCTAAATGGCCAACCAGGGAC 26,910-26,932
P18 CGAGCATCTCGTTTAGTTCGTT 28,056-28,077
P19 AGA AAGGTCAGAGCAAGATGTG 27,963-27,984
P20 GTATCACTATCA AAAGGA AAAT 28,559-28,580
P-F CAAACTGAATGGAAATAATCAA 139-160
P-R ATTTGGCAATGCTAGATTTAGTAA 28,441-28,464