Skip to main content

Table 2 Real-time quantitative RT-PCR probes and primers

From: Differential modulation of immune response and cytokine profiles in the bursae and spleen of chickens infected with very virulent infectious bursal disease virus

Target   Probe or primer sequence (5′–3′) Accession no. Annealing temperature
CXCLi2 Probe (FAM)-TCTTTACCAGCGTCCTACCTTGCGACA-(BHQ1) AJ009800 60°C
F GCCCTCCTCCTGGTTTCAG  
R TGGCACCGCAGCTCATT  
GAPDH Probe (FAMa)-CGCCATCACTATCTTCCAGG-(BHQ1) NM_204305 58°C
Fb GAACGGGAAACTTGTGAT  
Rb GACTCCACAACATACTCA  
IFN-γ Probe (FAM)-TGGCCAAGCTCCCGATGAACGA-(BHQ1) Y07922 58°C
F GTGAAGAAGGTGAAAGATATCATGGA  
R GCTTTGCGCTGGATTCTCA  
IL-1β Probe (FAM)-CCACACTGCAGCTGGAGGAAGCC-(BHQ1) AJ245728 60°C
F GCTCTACATGTCGTGTGTGATGAG  
R TGTCGATGTCCCGCATGA  
IL-10 Probe (FAM)-CGACGATTCGGCGCTGTCACC-(BHQ1) AJ621614 58°C
F CATGCTGCTGGGCCTGAA  
R CGTCTCCTTGATCTGCTTGATG  
IL-12α Probe (FAM)-CCAGCGTCCTCTGCTTCTGCACCTT-(BHQ1) AY262751 58°C
F TGGCCGCTGCAAACG  
R ACCTCTTCAAGGGTGCACTCA  
IL-18 Probe (FAM)-CCGCGCCTTCAGCAGGGATG-(BHQ1) AJ276026 60°C
F AGGTGAAATCTGGCAGTGGAAT  
R ACCTGGACGCTGAATGCAA  
  1. aFAM, 6-carboxyfluorescein; BHQ1, Black Hole Quencher.
  2. b F, forward primer; R, reverse primer.