Skip to main content

Table 1 GeXP primers sequence and amplicon sizes designed for quantification of chicken cytokines, chemokines and other immune-related genes

From: Differential modulation of immune response and cytokine profiles in the bursae and spleen of chickens infected with very virulent infectious bursal disease virus

Gene Accession number Amplicon size (bp) Forward primer sequence* (5′–3′) Reverse primer sequence** (5′–3′)
Cytokines and chemokines
CCL4 NM_204720 235 CTGCTCAAAGCCTGCCATC GTGCAGCCATCCTGAAGC
CXCLi1 NM_205018 228 CCGATGCCAGTGCATAGAG CCTTGTCCAGAATTGCCTTG
CXCLi2 NM_205498 165 CCTGGTTTCAGCTGCTCTGT GCGTCAGCTTCACATCTTGA
GM-CSF NM_001007078 242 TGAAAACAAATGGGACAGAGG TTCTCCTCTGGGAGCACATC
IFN-γ NM_205149 214 GAGCCATCACCAAGAAGATGA TAGGTCCACCGTCAGCTACA
IL-1β NM_204524 137 CCAGAAAGTGAGGCTCAACA GTAGCCCTTGATGCCCAGT
IL-2 NM_204153 144 GTGGCTAACTAATCTGCTGTCCA CCGTAGGGCTTACAGAAAGG
IL-4 NM_001007079 151 CGTCAAGATGAACGTGACAGA AGGTTCTTGTGGCAGTGCT
IL-6 NM_204628 158 AGTTCACCGTGTGCGAGAAC TTCGTCAGGCATTTCTCCTC
IL-10 NM_001004414 172 TAACATCCAACTGCTCAGCTC TGATGACTGGTGCTGGTCTG
IL-12α NM_213588 179 AAGGGACTCAACTGCTCCAG TTGTGTTGCTCTGACTGTTGG
IL-15 NM_204571 193 ATTCCCGATCCAGATTCTGTT ACAGTTGGTACTGGAGACAAATACT
IL-16 NM_204352 200 GCCTCACAAGAATCAACAACTG TGCTTTGTTCCAACGAGGTC
IL-17 F NM_204460 340 TCCATGGGATTACAGGATCG AGGCAAGGCAGTTCTCCTG
IL-18 NM_204608 207 CGTCAATAGCCAGTTGCTTG CTTCTACCTGGACGCTGAATG
IL-21 NM_001024835 186 TGTGGTGAAAGATAAGGATGTCG CAGTTTTGGCGAATGTAGCA
IL-22 XM_416079 256 CAGCCCTACATCAGGAATCG GAACTGTGCCACATCCTCAG
TGF-β3 NM_205454 347 AATCAGCATACACTGCCCTTG TCGGAAGTCAATGTAAAGAGGAC
TNFSF13B NM_204327 333 GGCAAGGTCTCCACTAGAGC TCAGAAGCCAAGGGACAATG
Toll-like receptors
TLR2-1 NM_204278 249 TCAGCTACACCAAAATGTTCAACC CGTGATTTTGCCTGTGAGC
TLR3 NM_001011691 263 TGCATAAGAAGGAGCAGGAAG CTGGCCAGTTCAAGATGCAG
TLR4 NM_001030693 270 CATCTCTGGAGTTCCTGCTG AGGCTGCTAGACCCAGGTG
TLR5 NM_001024586 277 CACTCAGGTTCTCGGTATTCG AATCCAGGTGCTTCAGCAAG
TLR7 NM_001011688 284 GAGTGAGTTATGCCACTCCTCTC TCAAAGGCTTCCACATCAC
Others     
iNOS NM_204961 221 TATGCTCTGCCTGCTGTTGC ATGCAAGTTTGTTGCTTTCC
MHCI NM_001044683 291 GGAAACCTGCGTGGAGTG TGGTGACCCAGGTGTGGTA
MHCII NM_001044679 298 AGTACGCGCACTTCGACA AGAAGCCCGTCACGTAGC
GAPDH NM_204305 312 CTGGCAAAGTCCAAGTGGTG AGCACCACCCTTCAGATGAG
KAN r*** - 325 ATCATCAGCATTGCATTCGATTCCTGTTTG ATTCCGACTCGTCCAACATC
  1. *Forward universal primer sequence (AGGTGACACTATAGAATA).
  2. **Reverse universal primer sequence (GTACGACTCACTATAGGGA).
  3. ***Internal control.