Skip to main content

Table 2 The list of primers for amplification of RT-qPCR

From: Feeding a high-grain diet reduces the percentage of LPS clearance and enhances immune gene expression in goat liver

Gene Forward primer Reverse primer Length
TLR4 CTGAGAACCGAGAGCTGGGAC GCCTTGAAATGTGTTGTCTTCA 207 bp
TLR2 GCTCAGGTGGAAGCTTTCCAG GGTGATCTCGTTGTTGGACAG 241 bp
IL-1A GATGATGACCTGGAAGCCATTG GCTGAGAATCCTCTTCTGATAC 259 bp
IL-1B CCGTGATGATGACCTGAGGAG CAAGACAGGTATAGATTCTTGTC 303 bp
IL-6 CGAAGCTCTCATTAAGCACATC CCAGGTATATCTGATACTCCAG 241 bp
TNF-α CAACAGGCCTCTGGTTCAGAC GGACCTGCGAGTAGATGAGG 209 bp
IL-8 CTGAGAGTTATTGAGAGTGGGC CAGTACTCAAGGCACTGAAGTAG 259 bp
IL-10 GTGATGCCACAGGCTGAGAAC GAAGATGTCAAACTCACTCATGG 213 bp
CCL5 CTACACCAGCAGCAAGTGCT CAAGCTGCTTAGGACAAGAGG 190 bp
CCL20 GAAGCAGCAAGCAGCTTTGAC GTTCCATTCCAGGGAGCATC 244 bp
SAA3 GACATTCCTCAGGGAAGCTG CTTCGAATCCTTCCGTACCTG 247 bp
Hp GGAGTACTCGGTTCGCTATCA CCATCGTTCATTGATGAGTGTG 280 bp
LBP GAGCTGTCCACCACCAAGATG CACACTCAGATCAAATGTACCG 243 bp