Skip to main content

Table 2 Sequences of primers used in the PCR assays

From: Fatal disease associated with Swine Hepatitis E virus and Porcine circovirus 2 co-infection in four weaned pigs in China

Primer Sequence 5’-3’ Reference
PRRSV ORF7 gene   [26]
PRRSV-F CCAAATAACAACGGCAAGCA  
PRRSV-R ATGCTGAGGGTGATGCTGTGA  
PCV2 ORF2 gene   [27]
PCV2.S4 CACGGATATTGTAGTCCTGGT  
PCV2.A4 CCGCACCTTCGGATATACTGTC  
HEV ORF2 gene   [3]
HEV- externer primer AATTATGCYCAGTAYCGRGTTG  
HEV- externer primer CCCTTRTCYTGCTGMGCATTCTC  
HEV- interner primer GTWATGCTYTGCATWCATGGCT  
HEV- interner primer AGCCGACGAAATCAATTCTGTC  
CSFV E2 gene   [28]
E2- externer primer GCATCAACCAYKGCATTCC  
E2- externer primer GTCTGTGTGGGTRATTAAGTTCCCTA  
E2- interner primer CTRGTRACTGGGGCACAAGG  
E2- interner primer ACCAGCRGCGAGTTGYTCTG  
PEDV S gene   [29]
P1 TTCTGAGTCACGAACAGCCA  
P2 CATATGCAGCCTGCTCTGAA  
TGEV S gene   [29]
T1 GTGGTTTTGGTYRTAAATGC  
T2 CACTAACCAACGTGGARCTA  
PRV gB genes   [30]
PRVF GGGGTTGGACAGGAAGGACACCA  
PRVR AACCAGCTGCACGCGCTCAA  
PPV NS1 gene   [30]
PPVF AGTTAGAATAGGATGCGAGGAA  
PPVR AGAGTCTGTTGGTGTATTTATTGG