Skip to main content

Table 1 Characteristics of gene specific primers used for qPCR

From: Treatment of lactating sows with clofibrate as a synthetic agonist of PPARα does not influence milk fat content and gains of litters

Gene Forward primer (from 5′ to 3′) PCR product size (bp) NCBI GenBank Slope R 2 Efficiency M-value
Reverse primer (from 5′ to 3′)
Reference genes
ACTB GACATCCGCAAGGACCTCTA 205 XM_003124280.3 −3.76 1.000 0.84 0.034
  ACATCTGCTGGAAGGTGGAC       
ATP5G1 CAGTCACCTTGAGCCGGGCGA 94 NM_001025218.2 −3.43 0.999 0.99 0.033
  TAGCGCCCCGGTGGTTTGC       
GSR AGCGCGATGCCTACGTGAGC 175 XM_003483635.2 −3.43 0.997 0.96 0.038
  GGTACGCCGCCTGTGGCAAT       
RPS9 GTCGCAAGACTTATGTGACC 325 XM_005664825.1 −3.78 0.999 0.84 0.034
  AGCTTGAAGACCTGGGTCTG       
PPARα target genes
ACOX1 CTCGCAGACCCAGATGAAAT 218 NM_001101028.1 −3.53 0.999 0.92  
  TCCAAGCCTCGAAGATGAGT       
CD36 TCCTCTGACATTTGCAGGTCAATCT 107 NM_001044622.1 −3.59 0.999 0.90  
  GGAGATGCAAAAGCTGTGGATGG       
CPT1A GCATTTGTCCCATCTTTCGT 198 NM_001129805.1 −3.46 0.999 0.95  
  GCACTGGTCCTTCTGGGATA       
CPT1B CACACTGCAGCACCTCACA 183 NM_001007191.1 −4.09 1.000 0.76  
  GTGAGGGCTGCCAGCTTTT       
CYP4A24 GGTTTGCTCCTGTTGAATGG 121 NM_214424.1 −3.34 1.000 0.99  
  GCATCACTTGGACAGACTTG       
FABP1 ATCGTGCAGAATGGGAAGCA 133 NM_001004046.1 −3.43 0.999 0.96  
  ACTGAACCACTGTCTTGACC       
FABP3 CAACATGACCAAGCCTACCA 227 NM_001099931.1 −3.36 1.000 0.98  
  CTAGTTCCCGAACAAGCGTT       
LPL TTCTCCCGACGACGCAGATTTT 166 NM_214286.1 −3.36 0.988 0.98  
  TGCAATCACACGGATGGCTTCT       
SLC27A1 GGTTCCAGCCTGTTGAATGT 275 NM_001083931.1 −3.38 0.992 0.98  
  AACAAAACCTTGGTGCTTGG       
UCP3 GCCACTTTGTCTCTGCCTTC 219 NM_214049.1 −3.39 1.000 0.97  
  CAAACATCACCACGTTCCAG       
Genes of the ubiquitin proteasome system
FBXO32 TCACAGCTCACATCCCTGAG 167 NM_001044588.1 −3.30 0.994 1.01  
  GACTTGCCGACTCTCTGGAC       
TRIM63 ATGGAGAACCTGGAGAAGCA 219 NM_001184756.1 −3.62 0.998 0.89  
  ACGGTCCATGATCACCTCAT       
UBB GGTGGCTGCTAATTCTCCAG 127 NM_001105309.1 −3.51 1.000 0.93  
  TTTTGGACAGGTTCAGCTATTAC       
  1. Abbreviations: ACOX1 acyl-CoA oxidase, ACTB  actin, beta, ATP5G1 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1, CD36 fatty acid translocase, CPT1 carnitine-palmitoyl-transferase, CYP4A24 cytochrome P450 A24, FABP fatty acid binding protein, FBXO32 F-box protein 32, LPL lipoprotein lipase, GSR glutathione reductase, PPARα peroxisome proliferator- activated receptor α, RPS9 ribosomal protein S9, SLC27A1 solute carrier family 27 (fatty acid transporter), member 1, TRIM63 tripartite motif containing 63, E3 ubiquitin protein ligase, UBB ubiquitin B, UCP3 uncoupling protein 3.