Skip to main content

Table 2 The primers used in the paper

From: Establishment of a mouse model to express bovine CD14 short hairpin RNA

Gene Primer sequences Fragment length (bp)
Histone H2a Forward: 5’-AACAAGCTGCTGGGCAAAGT-3’ 80
Reverse: 5’-TTATGGTGGCTCTCCGTCTTCT-3’
Probe: 5’-CCCAACATCCAGGCCGTGCTG-3’
CD14 Forward: 5’-CCGTTCAGTGGTAATGGTTGC-3’ 100
Reverse: 5’-TGGTGTCGGCTCCCTTGAG-3’
Probe: 5’-CCGCCCGCCACTGATCTTCCCACCTCTT-3’
EGFP Forward: 5’- ACGTAAACGGCCACAAGTTC -3’ 440
Reverse: 5’- GATCTTGAAGTTCACCTTGATGC -3’
Neo Forward: 5’- AGAGGCTATTCGGCTATGAC -3’ 211
Reverse: 5’-GCTTCAGTGACAACGTCGAG -3’
IRES Forward: 5'-CGGAATATTATAACTTCGTATAATGTATGCTATACGAAGTTATCTTCCGACATTGATTATTGAC-3' 4300
Reverse: 5'-CGGAATATTATAACTTCGTATAGCATACATTATACGAAGTTATGATCCAGACATGATAAGATAC-3'
TLR4 Forward: 5’-CTGCCTGAGAACCGAGAGTTG-3’ 300
Reverse: 5’-GCTCCATGCACTGGTAACTAATGT-3’
IL-6 Forward: 5’- ATCAGAACACTGATCCAGATCC-3’ 300
Reverse: 5’-CAAGGTTTCTCAGGATGAGG-3’
TNF-α Forward: 5’-GCTCCAGAAGTTGCTTGTGC-3’ 300
Reverse: 5’-AACCAGAGGGCTGTTGATGG-3’
MD2 Forward: GAGTTGCCGAAGCGTAAG 213
Reverse: GCGGTGAATGATGGTGAA
β-actin Forward: 5’-GCCCTGGCACCCAGCACAAT-3’ 150
Reverse: 5’-GGAGGGGCCGGACTCATCGT-3’