Skip to main content

Table 2 Primers used for amplification of FMDV VP1 cDNA in this study

From: Characterisation of recent foot-and-mouth disease viruses from African buffalo (Syncerus caffer) and cattle in Kenya is consistent with independent virus populations

Primer name Sequence (5ˈ-3ˈ) Isolate of origin Reference
1.0 PN 15 (NK-72) (reverse) GAAGGGCCCAGGGTTGGACTC Accession no. AJ 539141 Mason et al., 2003 [35].
13-KPN 100 (forward) GGGTGGBBGTSTWMCAGRTSACMGACAC K127/2011 This study
13-KPN 101(forward) CACTGCTAYCAYKCNGARTGGGA K10/2012 This study
1.0-U PN E (AKS-2) (forward) TTAACTACCACTTCATGTACACXG Accession no AY593849 Sangula et al., 2010 [36].
  1. V = A,C,G; H = A,C,T; B = C,G,T; S = C,G; W = A,T; M = A,C; R = A,G; Y = C,T; K = G,T; N = Any; X = Inosine.