Skip to main content

Table 1 Sequence of primers used for qRT-PCR

From: The effect of Zhangfei/CREBZF on cell growth, differentiation, apoptosis, migration, and the unfolded protein response in several canine osteosarcoma cell lines

Xbp1 spliced-forward TCTGCTGAGTCCGCAGCAGG
spliced-reverse TAAGGAACTGGGTCCTTCT
HERP forward CCGAGCCTGAGCCCGTCACG
reverse CTTTGGAAGCAAGTCCTTGA
CHOP forward TGGAAGCCTGGTATGAGGAC
reverse TGCCACTTTCCTCTCGTTCT
GRP78 forward GGCTTGGATAAGAGGGAAGG
reverse GGTAGAACGGAACAGGTCCA
osteocalcin forward AAGCRGGAGGGCAGCAGGT
reverse CYGRTARGCYTCCTGRAAGC
GAPDH forward TGCCTCCTGCACCACCAACTGC
reverse GGGCCATCCACAGTCTTCTGGG
  1. All sequences are in the 5′–3′ direction.