Skip to main content

Table 1 Sequences of primers used for PCR amplification and sequencing of the nsp2 and ORF5 regions in the VR2332 genome

From: Effects of ribavirin on the replication and genetic stability of porcine reproductive and respiratory syndrome virus

Sequenced region Primer name Nucleotide location a Sequences (5′-3′) Sequenced length (bp)
nsp2 pnsp2F 1249-1268 CCTCCTCAGAATAAGGGTTG 3588
pnsp2R 5120-5138 TGTCAAGGGCAGGGTAAG
1a 1481R 1463-1481 GGGAGTAGTGTTTGAGGTG
1a 1366F 1366-1383 CTCTTGTGCGACTGCTAC
1a 2115R 2097-2115 TACAGGTCAATCTTTGCTG
1a 2058F 2058-2075 CCCAGAACAAAACCAACC
1a 2867R 2850-2867 ATTGCGGTGAGGACACAA
1a 2771F 2771-2788 TGGGAAGATTTGGCTGTT
1a 3581R 3563-3581 CAATGGTAAGGTCGCTCTC
1a 3511F 3511-3529 TCCGTGTGAGTTTGTGATG
1a 4276R 4258-4276 CAGTAACCTGCCAAGAATG
1a 4141F 4141-4158 CGCTGCTTGTGAGTTTGA
ORF5 pP5Fr 13716-13734 CCTGAGACCATGAGGTGGG 603
pP5Rr 14457-14479 TTTAGGGCATATATCATCACTGG
  1. a: Location of primers in the full-length VR2332 genome (GenBank accession [AY150564]). p: primers used for PCR amplification and sequencing. The remaining primers were used only for sequencing. r: reference primers used in a previous study [17].