Skip to main content

Table 2 NanoPCR and conventional PCR target gene and primers used for amplification of MEV

From: Development of a nanoparticle-assisted PCR (nanoPCR) assay for detection of mink enteritis virus (MEV) and genetic characterization of the NS1 gene in four Chinese MEV strains

Primer name a Length (nt) Genome position b Sequence (5′-3′) Melting temperature (°C) Product (bp)
P1 20 1906-1925 ACAAGCGGCAAGCAATCCTC 54.9 194
P2 20 2080-2099 CTGCCTCTATTTCGGACCAT   
P3 23 151-173 CGCCATGTCTGGCAACCAGTATA 56 2013
P4 25 2139-2163 GGTTAATCCAAGTCGTCTCGAAAAT
  1. aP1 and P2 were used to amplify a portion of the NS1 gene (194 bp). P3 and P4 were used to amplify the full-length MEV NS1 gene (2,013 bp).
  2. bThe nucleotide positions of the nanoPCR and conventional PCR primers are according the genome sequence of mink enteritis virus strain MEVB (GenBank accession number FJ592174).