Skip to main content

Table 1 Primers and PCR conditions

From: Enhanced Wnt/β-catenin and Notch signalling in the activated canine hepatic progenitor cell niche

Gene Direction Sequence (5’- 3’) Tm (°C) Product size (bp) Genbank accession number
B2MGa Forward TCCTCATCCTCCTCGCT 60.3 85 XM_535458
  Reverse TTCTCTGCTGGGTGTCG    
HPRTa Forward AGCTTGCTGGTGAAAAGGAC 58 114 NM_001003357
  Reverse TTATAGTCAAGGGCATATCC    
RPS5a Forward TCACTGGTGAGAACCCCCT 62.5 141 XM_533568
  Reverse CCTGATTCACACGGCGTAG    
RPS19a Forward CCTTCCTCAAAAAGTCTGGG 61 95 XM_533657
  Reverse GTTCTCATCGTAGGGAGCAAG    
FZD1 Forward GGCGCAGGGCACCAAGAAG 58.8 97 XM_539411
  Reverse GAGCGACAGAATCACCCACCAGA    
TCF3 Forward GGTGAATGAGCGGGTCCTGAACA 58.8 128 XM_849145
  Reverse TGAGCTGGCTGGCACGGTAGTC    
AXIN2 Forward CACCCGCTCTACAACAAGGT 60 128 XM_548025
  Reverse AGGTGGAGATGAAGCACAGC    
NOTCH1 Forward TACCGGCCAGAACTGTGAGGAGAA 56 108 XM_537795
  Reverse GGAGGGCAGCGGCAGTTGTAAGTA    
NOTCH2 Forward AGCACGCATCCTGGCATACCTC 58.3 106 XM_853135
  Reverse TGGGGATTAGCTGGAAAGTCACAA    
NOTCH3 Forward TCTGCCAGAGTTCCGTGGTG 66.8 117 XM_847948
  Reverse ATGGGGTACAAGGGCTGCTG    
NOTCH4 Forward GGAAGGGAGCCAGGGACCAACACA 68 96 NM_004557
  Reverse TCAGGGCCACAGCGGGACAAATC    
JAG1 Forward GGGCAACACCTTCAATCTCAAG 58.5 122 XM_853730
  Reverse CATTACTGGAATCCCACGCTTC    
JAG2 Forward GGGTACGTGCGTGGGC 64   XM_548004
  Reverse CACCGTTGTAGCAAGGCAG    
HEY1 Forward CCAGGAAAAGACGAAGAGGC 62.5 226 NM_001002953
  Reverse CTCCGATAGTCCATAGCAAGGG    
  1. Table legend text. aReference genes.