Skip to main content

Advertisement

Table 2 List of the primers used during this study

From: Use of in vivo induced antigen technology to identify genes from Aeromonas salmonicida subsp. salmonicida that are specifically expressed during infection of the rainbow trout Oncorhynchus mykiss

Primer name: Annealing temperature Amplicon size (bp) Sequence:
Trout Bact F 53°C 260 ATGGAAGGTGAAATCGCC
Trout Bact R    TGCCAGATCTTCTCCATG
16S rRNA- Forward 57°C 148 ATATTGCACAATGGGGGAAA
16S rRNA- Reverse    GTTAGCCGGTGCTTCTTCTG
UDP- Forward 57.5°C 94 CCGATTATCTCCCGGTTTTA
UDP-Reverse    CCGTTGAGGATCAGGGTAAT
RpoD- Forward 50°C 157 ACAAAGCTCCGTTGCAGAGT
RpoD- Reverse    ACCGATATGGGTAGCAGTCG
Hypothetical protein- Forward 50°C 145 AATCTGCTGTTCGTCGATCC
Hypothetical protein- Reverse    AAAACACGCAGAGCCAGACT
TonB- Forward 55°C 139 GTTGGTGGTCTGGGTACCTG
TonB- Forward    TCAATGACTCACCGGCCAAA